text

Kamis, 07 Desember 2017

NCBI Isolat IHB B 15650 16 S

Berdasarkan sequencing pada NCBI bakteri yang didapatkan yaitu Bacillus siamensis dengan kode genbank KM817243 dan memiliki kemiripan sebesar 98%

GenBank :

Query  15    CTAATGC-TGCAAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTAGCGGCGGACG  73
             ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  35    CTAATACATGCAAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTAGCGGCGGACG  94

Query  74    GGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCT  133
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95    GGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCT  154

Query  134   AATACCGGATGGTTGTTTGAACCGCATGGTTCAGACATAAAAGGTGGCTTCGGCTACCAC  193
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  155   AATACCGGATGGTTGTTTGAACCGCATGGTTCAGACATAAAAGGTGGCTTCGGCTACCAC  214

Query  194   TTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACG  253
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  215   TTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACG  274

Query  254   ATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTC  313
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  275   ATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTC  334

Query  314   CTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCC  373
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  335   CTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCC  394

Query  374   GCGTGAGTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTGCCG  433
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395   GCGTGAGTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTGCCG  454

Query  434   TTCAAATAGGGCGGCACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCA  493
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  455   TTCAAATAGGGCGGCACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCA  514

Query  494   GCAGCCGCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTC  553
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  515   GCAGCCGCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTC  574

Query  554   GCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGA  613
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  575   GCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGA  634

Query  614   AACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGGTGAAATGCG  673
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  635   AACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGGTGAAATGCG  694

Query  674   TAGAGATGTGGAGGAACACCAGTGGCGAAGGCGACTCTCTGGTCTGTAACTGACGCTGAG  733
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  695   TAGAGATGTGGAGGAACACCAGTGGCGAAGGCGACTCTCTGGTCTGTAACTGACGCTGAG  754

Query  734   GAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGAT  793
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  755   GAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGAT  814

Query  794   GAGTGCTAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTC  853
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  815   GAGTGCTAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTC  874

Query  854   CGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAG  913
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  875   CGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAG  934

Query  914   CGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAGGTCTTGACATCC  973
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  935   CGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAGGTCTTGACATCC  994

Query  974   TCTGACAATCCTAGAGATAGGACGTCCCCTTCGGGGGCAGAGTGACAGGTGGTGCATGGT  1033
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  995   TCTGACAATCCTAGAGATAGGACGTCCCCTTCGGGGGCAGAGTGACAGGTGGTGCATGGT  1054

Query  1034  TGTCGTCAGCTCGTGTCGTGAGATGTTGGGGTTAAGTCCCGCAACGAGCGCAACCCTTGA  1093
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct  1055  TGTCGTCAGCTCGTGTCGTGAGATGTT-GGGTTAAGTCCCGCAACGAGCGCAACCCTTGA  1113

Query  1094  TCTTAGTTGCCAGCATTCAGTTGGGCACTCTAAAGGTGACTGCCCGGTGACAAACCCGGA  1153
             ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||
Sbjct  1114  TCTTAGTTGCCAGCATTCAGTTGGGCACTCTAA-GGTGACTGCC-GGTGACAAACC-GGA  1170

Query  1154  GGAAAGGTGGGGGATGACGTCCAAATCATCCTTGCCCCTTATTGACCT  1201
             |||| ||||||| |||||||| |||||||| | ||||||||| |||||
Sbjct  1171  GGAA-GGTGGGG-ATGACGTC-AAATCATCAT-GCCCCTTAT-GACCT  1213
Genom Bacillus siamensis KCTC 13613T (5BCC 22614T5KACC16244T), dengan nilai hibridisasi DNA-DNA yang dihitung (DDH) sebesar 91,2% dan rata-rata identitas nukleotida (ANI) sebesar 98,9%. Nilai DDH ini jauh di atas 70% ambang batas untuk delineasi spesies, serta ambang ANI 95%. Selain itu, hasilnya analisis morfologi, fisiologis, chemotaxonomic dan filogenetik menunjukkan bahwa Jenis strain kedua taksa ini sangat mirip dengan koherensi fenotip. Sebuah genom inti Analisis sekuensing multi-lokus dilakukan untuk strain dan hasilnya menunjukkan bahwa Kelompok 'Bacillus vanillea' XY18 erat dengan jenis strain Bacillus siamensis. Data fenotipik yang diterbitkan sebelumnya untuk 'B. vanillea dan B. siamensis konsisten dengan strain yang dimiliki ke spesies yang sama.  Mester asam lemak yang sebelumnya diterbitkan Data sedikit bervariasi, namun komponen asam lemak primer adalah sama. Penyimpangan penting lainnya ditemukan ketika membandingkan fenotipik yang telah diterbitkan sebelumnya, sifat fisiologis atau kemotaksonomi dari keduanya taksa adalah: (1) mol% G + C isi DNA, (2) produksi asam dari laktosa, trehalosa dan melibiose, dan (3) suhu dan rentang pertumbuhan NaCl (1).
Bacillus siamensis (si.am.en9sis N.L. masc. Adj. Siamensis berkaitan dengan Siam, nama lama Thailand, dari mana jenis regangan diisolasi). Sel Gram-positif, fakultatif anaerobik dan rodshaped, berukuran 0,3-0,661,5-3,5 mm. Sel terjadi sendiri, berpasangan dan kadang dalam rantai pendek. Mereka motil dengan flagella peritrichous. Endospora Ellipsoidal adalah diproduksi di posisi sentral atau subterminal yang bengkak sporangia Koloni berwarna putih krem, mucoid, tembus, Dibesarkan, memiliki seluruh margin dan berdiameter 3-4 mm Setelah 2 hari inkubasi pada suhu 37oC pada TSA. Dalam medium cair, sebuah film tipis terbentuk di permukaan sementara sisanya sedang berawan. Pertumbuhan anaerobik terjadi. Tumbuh pada agar MacConkey tapi tidak di media garam empedu. Menghasilkan katalase tapi bukan oksidase (2).
Empat kelompok bakteri, Actinobacteria, Bacteroidetes, Firmicutes, dan Proteobakteria (Tabel 3, Gambar 2). Lebih dari setengah dari tanah antagonis bakteri (46 isolat, 52,3% dari total) diakomodasi dalam Firmicutes kelompok. Dalam kelompok ini, Bacillus spp. mewakili mayoritas, dengan 42 isolat (91,3%). Analisis filogenetik berdasarkan rRNA 16S Urutan gen menunjukkan bahwa isolat Bacillus yang paling aktif adalah terkait erat dengan spesies Bacillus thuringiensis (12 isolat,28,6%), Bacillus aryabhattai (9 isolat, 21,4%) dan Bacillus siamensis (5 isolat, 11,9%) dengan urutan kemiripan 99.9e100.0%,98.9e100.0%, dan 99.1e100.0%, masing-masing (3).
Di sini, selama pendekatan sistematis untuk memindai spesies Bacillus yang menghasilkan antibiotik baru com-Pound, kami menemukan bahwa Bacillus siamensis KCTC 13613T signifikan menghambat pertumbuhan miselium tanaman-jamur pathogen Rhizoctonia solani dan Botrytis cinerea (data tidak ditunjukkan). Itu Strain KCTC 13613T juga menunjukkan aktivitas antibakteri yang kuat melawan bakteri Gram positif, Micrococcus luteus. B. siamensis adalah spesies halophilic baru yang diisolasi dari jenis produk kepiting asin (poo-khem) dimakan di Thailand (11). Ketegangan KCTC 13613T secara signifikan meningkatkan pertumbuhan bibit Arabi-dopsis thaliana tanpa kontak fisik di I Plate, menunjukkan bahwa volatile bakteri mendorong pertumbuhan tanaman (data tidak ditunjukkan) (4).
    isolat menghasilkan metabolit inhibitor yang disebarkan ke media agar-agar dan dihambat pertumbuhan patogen, menghasilkan formasi zona penghambatan (Gambar 3C, Gambar 3D). Antara isolat endofitik, B. siamensis C53 dan B. subtilis cenB menunjukkan antagonis yang signifikan aktivitas sementara isolat epifit menunjukkan tidak berpengaruh pada patogen yang teruji. Dari 70 terisolasi bakteri tanaman terkait, Bacillus sp., Serratia sp., Pseudomonas sp., Pantoea sp., dan Lysinibacillus sp. Menunjukkan sifat promosi pertumbuhan tanaman yang manjur. Bacillus siamensis C53 dan B. subtilis cenB menunjukkan signifikan aktivitas antagonistik terhadap patogen yang diuji (5).

Daftar Pustaka 

1.    Dunlap, C.A. Phylogenomic analysis shows that ‘Bacillus vanillea’ is a later heterotypic synonym of Bacillus siamensis. International Journal of Systematic and Evolutionary Microbiology. 2015; 3507-3510.
2.     Sumpavapol, P., L,Tongyonk, S, Tanasupawat., N, Chokesajjawatee., P, Luxananil3 dan W, Visessanguan. Bacillus siamensis sp. nov., isolated from salted crab (poo-khem) in Thailand. International Journal of Systematic and Evolutionary Microbiology. 2010; 2364-2370
3.     Fan,Z., C, Miao., X, Qiao, Y, Zheng , Hu, Chen.,Y, Chen., LI, Xu., L, Zhao dan H, Guan. Diversity, distribution, and antagonistic activities of rhizobacteria of Panax notoginseng. Journal of Ginseng Research. 2015; 97-104
4.    Jeong,H., D, Jeong., S,H Kim, G,C Song., S, Park, C, Ryu, S, Park, dan S, Choia,b. Draft Genome Sequence of the Plant Growth-Promoting Bacterium Bacillus siamensis KCTC 13613T. Journal of Bacteriology. 2012;194(54):  4148-4149
5.      Nongkhlaw, F, M, W dan S. R. Joshi. Epiphytic and endophytic bacteria that promote growth of ethnomedicinal plants in the subtropical forests of Meghalaya, India. Int. J. Trop. Biol. 2014;62(4): 1295-1308.